rs1744286 chr14:104094675 A>G
- Sequence
cccaggacaggaccctccatttgt[A/G]gccggcagccctcaccgggcaagg
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.14 | 0.73 | 1.99 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.50 | 0.27 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cortex, Esophagus_Muscularis, Lung, Nerve_Tibial, Stomach, Testis