rs17456987 chr9:129290732 G>C
- Sequence
tagggctggcctttgagcacctga[G/C]tagcaggtgcatggttgagattcg
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -3.11 | 2.85 | 1.50 | 2.28 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
