rs17492028 chr1:89552738 G>A
- Sequence
tgattgcttaaccctgctccctgt[G/A]ttcaccaggcgggttggtgaaagc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.27 | 0.73 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.64 | -0.33 | 1.93 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood