rs17498131 chr12:115998380 C>G
- Sequence
atttaaacagaccaataataacca[C/G]tgaatcactaagatctgactccta
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.60 | -0.12 | 2.02 | |||
| foreskin keratinocyte | 0.90 | n/a | 2.50 |
Items per page:
1 – 2 of 2