rs17513809 chr6:139508780 G>A
- Sequence
aatctttcattgaaagaactttga[G/A]tgcttcataaacattgcttcacga
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN SOX13_HUMAN CEBPA_HUMAN FOXA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 1.08 | -2.68 | 2.00 | n/a | No Hit | |||
| SOX13_HUMAN | 2.69 | n/a | 2.00 | n/a | n/a | |||
| CEBPA_HUMAN | 2.11 | -1.59 | 2.00 | n/a | No Hit | |||
| FOXA3_HUMAN | 2.55 | n/a | 2.00 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.49 | -0.61 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, bipolar disorder, fasting blood glucose, fasting insulin, hdl cholesterol, homa-ir, mean corpuscular volume (mcv), salmonella-induced pyroptosis, waist hip ratio