rs17562530 chr17:64187495 C>G
- Sequence
gtcactaccttcacattgatccag[C/G]cttcactatgacagtcacctccca
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.84 | -0.13 | 1.99 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.03 | 0.65 | 1.77 |
Items per page:
1 – 2 of 2