rs1759188 chr1:16634525 A>G
- Sequence
cctgtaatcccagcactgtgggag[A/G]ccgaggcgggagggtcacctgagg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.07 | 0.39 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.76 | -0.33 | 2.36 | |||
| HepG2 (hepatoblastoma) | 1.00 | -0.17 | 1.56 |
Items per page:
1 – 3 of 3