rs176648 chr15:89396297 T>G
- Sequence
actgtcggttagggagtgtaaatt[T/G]tgcaatattttctgaaatgtggca
- ASB in cell types
- LHSAR (prostate epithelial cells) CD14+ monocytes SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
- ASB for transcription factors
- ANDR_HUMAN STAT1_HUMAN CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.68 | 1.30 | 1.44 | n/a | No Hit | |||
| STAT1_HUMAN | -3.42 | 2.23 | 2.50 | n/a | No Hit | |||
| CEBPA_HUMAN | 0.51 | 1.80 | 2.00 | 3.19 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, cystatin c in serum, height, infant head circumference
GTEx eQTL Brain_Caudate_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Thyroid