rs17699074 chr3:28756375 T>G
- Sequence
gggtcaaagaggtagccctaggct[T/G]tctataggttttggaaaagaaggg
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.11 | -2.94 | 2.00 | 0.07 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, diastolic blood pressure (dbp), hdl cholesterol, total cholesterol