rs17714747 chr2:204145468 G>A
- Sequence
ccaagcgctaaacctgcttcatag[G/A]agagcacattaagctgagaaggag
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) H1 (embryonic stem cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.22 | 0.63 | 1.96 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.24 | 0.72 | 1.38 | |||
| H1 (embryonic stem cells) | 0.95 | 0.11 | 1.41 | |||
| HEK293 (embryonic kidney) | 0.12 | 0.45 | 1.31 | |||
| CD34+ stem cells-derived erythroblasts | 1.76 | -0.90 | 2.00 |
Items per page:
1 – 5 of 5