rs177863 chr14:37650645 C>A
- Sequence
ttgcttacatcctgcttcttgtct[C/A]tgctagatctgtgaggtcaggtcg
- ASB in cell types
- HepG2 (hepatoblastoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.01 | 0.77 | 1.83 | |||
| ZR-75-1 (invasive ductal carcinoma) | -0.19 | 1.88 | 2.00 |
Items per page:
1 – 2 of 2