rs1780601 chr1:15248734 A>T
- Sequence
cgattagctgggactacaggtgca[A/T]gccaccatgcccggctaatttttt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | n/a | 1.59 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Stomach, Thyroid, Whole_Blood