rs17837697 chr7:156827951 T>C
- Sequence
tttctgtgaattcattttgctcaa[T/C]agacaccgcatttcctgggaaaag
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.50 | 0.24 | 1.51 | |||
| 22RV1 (prostate carcinoma) | -2.03 | 1.91 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, ldl cholesterol, lp-pla2 activity, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood