rs178723 chr5:172766871 A>G
- Sequence
agtggggtggggcgctaaggggcc[A/G]gtaatccaagagcttcgctgtttc
- ASB in cell types
- upper lobe of left lung K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 2.01 | 0.44 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.00 | 0.46 | 2.00 |
Items per page:
1 – 2 of 2