rs179117 chr20:57941806 G>A
- Sequence
tccctcctggagaggtgtcctggc[G/A]ggggcggccatgtggggtgaggtc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.13 | 0.85 | 2.05 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.12 | -0.66 | 3.79 |
Items per page:
1 – 2 of 2