rs179158 chr14:95507273 C>T
- Sequence
cactgggcagcgctgtgtctctgg[C/T]atcttcctagttcgtgtccacctc
- ASB in cell types
- CD14+ monocytes MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.44 | 0.55 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.09 | -3.36 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood