rs179436 chr11:2532919 A>G
- Sequence
ggtacgagaagcaaaggtgtttgc[A/G]gcccttggggccaggcggcgggaa
- ASB in cell types
- GM12867 (female B-cells) neutrophils epidermal keratinocytes kidney
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12867 (female B-cells) | n/a | 2.54 | 1.50 | |||
| neutrophils | 2.03 | -0.08 | 1.67 | |||
| epidermal keratinocytes | -3.11 | 2.39 | 2.00 | |||
| kidney | -1.70 | 2.15 | 2.00 | |||
| foreskin keratinocyte | n/a | 0.32 | 2.67 |
Items per page:
1 – 5 of 5