rs179736 chr14:31022616 C>T
- Sequence
aatgtactcaagtggtgtgggcca[C/T]gcaatactagatgaagaattacaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.36 | 0.68 | 1.74 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age-related hearing impairment, bipolar disorder, body mass index (bmi), coronary artery disease (cad), diastolic blood pressure (dbp), irritible bowel syndrome, parkinsons disease, systolic blood pressure (sbp)