rs1807198 chr15:96335065 A>G
- Sequence
gggaaaagtttgcctgctaactca[A/G]taggagttggagctccaggcaaat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.44 | -0.14 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), celiac disease, hdl cholesterol, hdl cholesterol change with statins, microalbuminuria, neuroblastoma (brain cancer), premature ovarian failure, rheumatoid arthritis, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease