rs181997 chr6:32932941 G>A
- Sequence
agggcagagaaaagcctgcactgg[G/A]aatctctagaaaaggaactggaag
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.89 | 0.51 | 2.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic hepatitis b, college completion, coronary artery disease (cad), ldl cholesterol, neuroblastoma (brain cancer), rheumatoid arthritis, sporadic creutzfeldt-jakob disease, total cholesterol, transmission distortion, triglycerides, years of education
GTEx eQTL Artery_Aorta, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood