rs1821968 chr2:111123046 C>T
- Sequence
ccttgcaggcgttcgcttcgtcgc[C/T]ctccgccgccccctccccatttag
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.37 | 1.03 | 2.00 | |||
| HEK293T (embryonic kidney) | 1.25 | -0.69 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Testis