rs182498 chr18:23499399 T>C
- Sequence
gatgcatgcgcacacaggcacgca[T/C]acacacacgcgcacacacgcgcac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KAISO_HUMAN | 2.15 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, hdl cholesterol, height, ldl cholesterol, mitral annular calcium, obesity with early age of onset (age >2), rheumatoid arthritis, years of education