rs1830593 chr1:185608459 G>A
- Sequence
gagctaaaagcagaactagcatat[G/A]atctggcaacctcattactgagta
- ASB in cell types
- germinal center B-cells periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 0.96 | -0.37 | 2.25 | |||
| periferal blood macrophages | 1.53 | -1.41 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting insulin, hdl cholesterol change with statins, mitral annular calcium, refractive error, waist hip ratio