rs1832147 chr9:136766650 T>G
- Sequence
gacgccagcgtctgggaagacacc[T/G]gttgccaagcggaccgtgatctag
- ASB in cell types
- HepG2 (hepatoblastoma) RH4 (alveolar rhabdomyosarcoma) MCF7 (Invasive ductal breast carcinoma) pancreas
- ASB for transcription factors
- CTCF_HUMAN CREB1_HUMAN RAD21_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.41 | 0.17 | 1.42 | n/a | No Hit | |||
| CREB1_HUMAN | 1.26 | -0.70 | 1.42 | n/a | No Hit | |||
| RAD21_HUMAN | 1.58 | -0.10 | 1.29 | n/a | n/a | |||
| SNAI2_HUMAN | n/a | 1.86 | 1.50 | -4.57 | Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Vagina, Whole_Blood