rs1834733 chr8:58524905 C>T
- Sequence
gttgttcctccttgtgtttggtct[C/T]ttttagcatgtgcctgctcccatt
- ASB in cell types
- K562 (myelogenous leukemia) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.15 | 1.16 | 2.00 | |||
| monocyte-derived dendritic cells | n/a | 2.07 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), ldl cholesterol, ldl cholesterol change with statins, schizophrenia, total cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid