rs183533 chr1:171610488 G>T
- Sequence
atttagagttccggaggctgggaa[G/T]tccaggagcatggtgccagcattt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | 2.12 | n/a | 2.75 | n/a | No Hit |
Items per page:
1 – 1 of 1