rs184953 chr7:116671876 A>C
- Sequence
gtgccaggagggtgcgcgccctgc[A/C]tctgagcccggggtgacactcgcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte thoracic aorta SK-N-SH (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.57 | 0.93 | 1.53 | n/a | No Hit |
Items per page:
1 – 1 of 1