rs185570 chr3:37547083 C>T
- Sequence
caggggcagtgatgtcattcccta[C/T]tgtgaggatcagtgacaccctcta
- ASB in cell types
- erythroid progenitors T47D (invasive ductal carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.32 | n/a | 2.50 | |||
| T47D (invasive ductal carcinoma) | 1.30 | -0.25 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.21 | 0.44 | 1.42 |
Items per page:
1 – 3 of 3