rs1858381 chr3:184145411 G>A
- Sequence
acctgggggagagggaggacgggt[G/A]tgccagccactaggtggtactgtg
- ASB in cell types
- erythroid cells T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.09 | n/a | 2.00 | |||
| T47D (invasive ductal carcinoma) | 1.85 | n/a | 4.50 |
Items per page:
1 – 2 of 2