rs1859333 chr12:112933161 T>C
- Sequence
tccccccttgaacctcactctacc[T/C]ctgctctcaatgccccatctactg
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | -2.91 | 1.51 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, homa-ir, hypertension (early onset hypertension), longstanding arthritis, parkinsons disease, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood