rs1860071 chr7:140210460 C>A
- Sequence
caacaggaggctgactgcaagcga[C/A]ctgcagatgccgagcctttgctgg
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.54 | -0.01 | 1.50 | |||
| periferal blood macrophages | 1.52 | -0.16 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Pancreas, Pituitary, Prostate