rs1863868 chr3:141368781 T>C
- Sequence
cccagggagttgacagcgtctggg[T/C]ttcagaggagccagcgcctccgag
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.14 | -0.42 | 2.03 | n/a | No Hit | |||
| MAX_HUMAN | 1.60 | -0.38 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), cystatin c in serum, height, homa-b, infant head circumference, myopia, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood