rs1864488 chr2:73112580 G>A
- Sequence
ggagcactcctcacgccactcggg[G/A]cagccgtgcgtcttctccaccacc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.06 | 0.80 | 1.98 | |||
| HepG2 (hepatoblastoma) | 0.65 | -0.01 | 1.97 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood