rs186588854 chr22:43187551 T>G
- Sequence
ggcaggccctgcgcatcggcgggg[T/G]gcgtgcgagagcgcgcgagcttgc
- ASB in cell types
- epithelial cell of prostate hepatocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.86 | 0.31 | 1.44 | 3.80 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
