rs1877151 chr1:214585278 A>G
- Sequence
agggaaaagacagaggaagacaga[A/G]aatgcagtgagtcagagtgtgtgg
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.01 | 0.18 | 1.31 | |||
| HEK293 (embryonic kidney) | -0.26 | 1.02 | 2.02 |
Items per page:
1 – 2 of 2