rs188440 chr19:47868876 C>T
- Sequence
tcagactgcttccctgaaattctt[C/T]taaagaaaatgcctgacaggaaat
- ASB in cell types
- A673 (Ewing sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A673 (Ewing sarcoma) | -1.32 | 1.61 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast cancer, hdl cholesterol, ldl cholesterol change with statins, nonalcoholic fatty liver disease (aspartate aminotransferase (ast)), serum dehydroepiandrosterone sulphate (dheas), serum dehydroepiandrosterone sulphate (dheas) (females), total cholesterol, total cholesterol change with statins, triglycerides