rs188586 chr17:58688117 T>G
- Sequence
cggcacttttacaattatagactt[T/G]ttttgttttgttttgtttttgaga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.06 | 1.37 | 5.89 | |||
| GM12878 (female B-cells) | n/a | 1.35 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, college completion, diastolic blood pressure (dbp), mitral annular calcium, serum creatinine, systolic blood pressure (sbp), years of education