rs189030 chr19:34329254 C>T
- Sequence
tgtaatctgtttccagagcctgaa[C/T]acctgactacttggtcatccaaaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.03 | 0.84 | 1.38 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, crohns disease, hip bone mineral density (bmd), irritible bowel syndrome, lp-pla2 activity, spine bone mineral density (bmd), urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Aorta, Brain_Cerebellum, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Thyroid