rs1892385 chr14:42224522 A>T
- Sequence
aacaaggagagcagtgcaattcca[A/T]ggaaggggacatagattttcttct
- ASB in cell types
- epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.63 | -1.34 | 2.00 |
Items per page:
1 – 1 of 1