rs1896781 chr19:17508286 T>C
- Sequence
ctcgcgtgtcataatgttggcatc[T/C]tgtttgttgtctctacctcagggg
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- JUN_HUMAN HDAC1_HUMAN PRD10_HUMAN MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.06 | n/a | 3.00 | n/a | No Hit | |||
| HDAC1_HUMAN | -0.37 | 1.62 | 2.00 | n/a | n/a | |||
| PRD10_HUMAN | -1.63 | 2.08 | 2.00 | n/a | n/a | |||
| MEIS2_HUMAN | -1.63 | 2.08 | 2.00 | n/a | No Hit | |||
| PKNX1_HUMAN | -2.73 | 2.20 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood