rs1898263 chr3:143971016 A>G
- Sequence
gcaacgcttcgcggcccgctcctc[A/G]gggaccctcaggggcggcaccggg
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.35 | -1.20 | 2.33 | |||
| GM12878 (female B-cells) | 0.43 | 0.52 | 1.31 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum