rs19039 chr11:86292003 A>G
- Sequence
accccctgctggagagttggcaaa[A/G]ttctgtgacattggtcaatttagt
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) foreskin keratinocyte erythroid progenitors MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.49 | 0.95 | 1.43 | n/a | No Hit | |||
| SMC3_HUMAN | 0.44 | 1.40 | 1.43 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood