rs1912196 chr2:214185796 G>T
- Sequence
gtcatgtggagaccagagagcaga[G/T]ggacctgaccactatatccaaagc
- ASB in cell types
- bipolar neuron
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -2.26 | 2.06 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive test performance, comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, longstanding arthritis, microalbuminuria, premature ovarian failure, serum creatinine