rs1919075 chr3:11001333 G>A
- Sequence
tacaagaggagagtggaggggacc[G/A]tgtctagaactcgagcttccccaa
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -1.65 | 1.98 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, attention-deficit/hyperactivity disorder (adhd), hdl cholesterol, response to anti-tumor necrosis factor treatment of rheumatoid arthritis, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio