rs1920116 chr3:169862183 G>A
- Sequence
tttggtggatgcaactgctaggga[G/A]gaagcagagatacttgcctcctca
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.68 | 0.29 | 1.94 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP celiac disease, college completion, glioma, high-grade glioma, premature ovarian failure, refractive error, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Testis, Thyroid, Whole_Blood