rs192671 chr3:191355917 C>A
- Sequence
ctttttgtggcattatccctcagt[C/A]gtgaaggacacaactaatgttgag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.45 | 0.62 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, coronary artery disease (cad), ldl cholesterol, longstanding arthritis, rheumatoid arthritis, schizophrenia
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood