rs1931574 chr1:94070741 T>A
- Sequence
gaagcgtgggtgtgggtgttgacc[T/A]ggcagtcgagtgggggaaggatgg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.18 | 0.63 | 1.99 |
Items per page:
1 – 1 of 1