rs193343 chr5:78051116 C>T
- Sequence
gtagatacacagagacaaaccaca[C/T]atattttatcagtttattacagta
- ASB in cell types
- K562 (myelogenous leukemia) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.16 | 0.75 | 2.00 | |||
| ZR-75-1 (invasive ductal carcinoma) | 1.33 | -0.76 | 2.00 |
Items per page:
1 – 2 of 2