rs1934221 chr6:149053469 C>A
- Sequence
cagggtcatatttttccctgtctt[C/A]tatgttcctctttgtggctataaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.64 | 0.33 | 1.36 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, diabetic retinopathy in type 2 diabetes mellitus, infant head circumference, mitral annular calcium, obesity with early age of onset (age >2), paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, salmonella-induced pyroptosis, triglycerides