rs1934495 chr1:163535990 G>A
- Sequence
aaataaaaactctgaagtgaccgt[G/A]ttccccagtagatgtcactactac
- ASB in cell types
- adrenal gland hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 1.11 | -0.87 | 1.11 | |||
| hepatocytes | -0.58 | 1.05 | 1.11 |
Items per page:
1 – 2 of 2